ID: 1133008256_1133008269

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1133008256 1133008269
Species Human (GRCh38) Human (GRCh38)
Location 16:2896544-2896566 16:2896593-2896615
Sequence CCCCCAGGAAGCCCAGAAAGTTC CAAAGACAGCACCAAGGTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 275} {0: 1, 1: 1, 2: 10, 3: 74, 4: 417}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!