ID: 1133008717_1133008728

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1133008717 1133008728
Species Human (GRCh38) Human (GRCh38)
Location 16:2898421-2898443 16:2898474-2898496
Sequence CCCATGGCCTGTGGGAGGCAGGG CACCAGGAGGTCCCTGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 405} {0: 1, 1: 1, 2: 6, 3: 26, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!