ID: 1133022831_1133022838

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1133022831 1133022838
Species Human (GRCh38) Human (GRCh38)
Location 16:2974376-2974398 16:2974421-2974443
Sequence CCAGCATCATGACAAGGACAGAA CCCATGAGGAAGGGCCACATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 220} {0: 1, 1: 1, 2: 1, 3: 18, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!