ID: 1133023390_1133023405

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1133023390 1133023405
Species Human (GRCh38) Human (GRCh38)
Location 16:2976755-2976777 16:2976807-2976829
Sequence CCAGGGCTCTGCAGAGTCTCTGA GCTGCAGCTGGTGCCAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 382} {0: 1, 1: 0, 2: 5, 3: 36, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!