ID: 1133033654_1133033668

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1133033654 1133033668
Species Human (GRCh38) Human (GRCh38)
Location 16:3023189-3023211 16:3023230-3023252
Sequence CCGCCTGTGATTCTGCAGAAGGC TACCTGAGTGGGGGCAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 188} {0: 1, 1: 0, 2: 3, 3: 39, 4: 401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!