ID: 1133034624_1133034635

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1133034624 1133034635
Species Human (GRCh38) Human (GRCh38)
Location 16:3027974-3027996 16:3028009-3028031
Sequence CCCTTGCCCAGCATCCTGGGGCG GCTTCTTTTGGAAGACAATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 238} {0: 1, 1: 0, 2: 2, 3: 18, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!