ID: 1133039263_1133039267

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1133039263 1133039267
Species Human (GRCh38) Human (GRCh38)
Location 16:3051506-3051528 16:3051527-3051549
Sequence CCTTCACCATGGCATCTAGACTG TGGTGTTTCACCAACCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 146} {0: 1, 1: 0, 2: 6, 3: 59, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!