ID: 1133046599_1133046610

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1133046599 1133046610
Species Human (GRCh38) Human (GRCh38)
Location 16:3091772-3091794 16:3091804-3091826
Sequence CCGCCAGCTCCTGATCTCGGGAA GGCCATGGTGAGGGGCCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 309} {0: 1, 1: 0, 2: 9, 3: 95, 4: 482}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!