ID: 1133051483_1133051491

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1133051483 1133051491
Species Human (GRCh38) Human (GRCh38)
Location 16:3119664-3119686 16:3119717-3119739
Sequence CCTACGCCTGCACTGACTGCGGG CAGCACCAGATCATCCACACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 104} {0: 2, 1: 2, 2: 21, 3: 95, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!