ID: 1133090691_1133090702

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1133090691 1133090702
Species Human (GRCh38) Human (GRCh38)
Location 16:3401530-3401552 16:3401573-3401595
Sequence CCTCGCTTAGCTCTACCGTTTAG GTCGGTTTCCGCCAGGATGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 17} {0: 1, 1: 0, 2: 0, 3: 0, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!