ID: 1133098116_1133098125

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1133098116 1133098125
Species Human (GRCh38) Human (GRCh38)
Location 16:3461349-3461371 16:3461391-3461413
Sequence CCCCTGCGGAGGTGGGCAGAGAG GCCACAGCTCTAAGCTGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 233} {0: 1, 1: 0, 2: 1, 3: 22, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!