ID: 1133130172_1133130180

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1133130172 1133130180
Species Human (GRCh38) Human (GRCh38)
Location 16:3671864-3671886 16:3671897-3671919
Sequence CCCTTTGTCTTCAGGCCTGGCCT ACGTGTGCTAAGAGGGAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 285} {0: 1, 1: 0, 2: 1, 3: 10, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!