ID: 1133155684_1133155690

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1133155684 1133155690
Species Human (GRCh38) Human (GRCh38)
Location 16:3873937-3873959 16:3873957-3873979
Sequence CCTACTATGTGTCAGGCACTGCC GCCCCTGGGGAGGGAAGTGCTGG
Strand - +
Off-target summary {0: 2, 1: 13, 2: 175, 3: 838, 4: 2834} {0: 1, 1: 0, 2: 5, 3: 63, 4: 582}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!