ID: 1133156575_1133156586

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1133156575 1133156586
Species Human (GRCh38) Human (GRCh38)
Location 16:3880484-3880506 16:3880509-3880531
Sequence CCGCCGCCGCCGCCGCCGCTGCC CGCCGCCGCCGCCGGGCTCCGGG
Strand - +
Off-target summary {0: 63, 1: 1208, 2: 1776, 3: 3026, 4: 6001} {0: 1, 1: 5, 2: 31, 3: 131, 4: 676}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!