ID: 1133201486_1133201504

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1133201486 1133201504
Species Human (GRCh38) Human (GRCh38)
Location 16:4206970-4206992 16:4207020-4207042
Sequence CCTTCCTGTGGCGCTCCACCTTC CCCGCCTTCCTGGGACTCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 256} {0: 1, 1: 0, 2: 4, 3: 36, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!