ID: 1133206784_1133206795

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1133206784 1133206795
Species Human (GRCh38) Human (GRCh38)
Location 16:4238866-4238888 16:4238919-4238941
Sequence CCACCTTGGGTTCCCAAAGCGCT CCACCGTGTTACCTTCTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 64, 2: 4108, 3: 68881, 4: 158673} {0: 1, 1: 0, 2: 1, 3: 6, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!