ID: 1133223586_1133223595

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1133223586 1133223595
Species Human (GRCh38) Human (GRCh38)
Location 16:4329421-4329443 16:4329453-4329475
Sequence CCACGGCCTAGTGCAGCTGCCCT GATGCAGCCTTGGGAGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 227} {0: 1, 1: 0, 2: 1, 3: 27, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!