ID: 1133234069_1133234078

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1133234069 1133234078
Species Human (GRCh38) Human (GRCh38)
Location 16:4379568-4379590 16:4379595-4379617
Sequence CCTGCTTTCTTCTGTCTGCCCTG GGCTGCTGGGGGGCTACCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 77, 4: 730} {0: 1, 1: 1, 2: 6, 3: 34, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!