ID: 1133250391_1133250394

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1133250391 1133250394
Species Human (GRCh38) Human (GRCh38)
Location 16:4476724-4476746 16:4476737-4476759
Sequence CCGCGGACGCCGCTCTCCAGAAG TCTCCAGAAGTCGTCTCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 59} {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!