ID: 1133268864_1133268868

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1133268864 1133268868
Species Human (GRCh38) Human (GRCh38)
Location 16:4600620-4600642 16:4600649-4600671
Sequence CCTGGATAGAGGGGAGGGGTCTG GGACCCCCATGCTGACCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 464} {0: 1, 1: 0, 2: 0, 3: 13, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!