ID: 1133281402_1133281406

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1133281402 1133281406
Species Human (GRCh38) Human (GRCh38)
Location 16:4667407-4667429 16:4667426-4667448
Sequence CCTTTTTAGTACTGGGCTCCCCA CCCAGCTGCTCTCCCCGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 93} {0: 1, 1: 0, 2: 5, 3: 42, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!