ID: 1133301975_1133301979

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1133301975 1133301979
Species Human (GRCh38) Human (GRCh38)
Location 16:4787982-4788004 16:4787998-4788020
Sequence CCAGGATGGGTGTTTGCAGCCAG CAGCCAGGCTGGAGTCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 138} {0: 1, 1: 0, 2: 10, 3: 157, 4: 2166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!