ID: 1133317015_1133317021

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1133317015 1133317021
Species Human (GRCh38) Human (GRCh38)
Location 16:4891179-4891201 16:4891220-4891242
Sequence CCTGCCACTGTCTGGTCATGAGG GTGAGATGGGAGTGTGAATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 166} {0: 1, 1: 1, 2: 0, 3: 16, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!