ID: 1133325540_1133325548

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1133325540 1133325548
Species Human (GRCh38) Human (GRCh38)
Location 16:4940105-4940127 16:4940144-4940166
Sequence CCACCACGCCCGGCCTTTAATTT GTCTCACTCTACCACCGGGCTGG
Strand - +
Off-target summary {0: 2, 1: 40, 2: 589, 3: 4145, 4: 17242} {0: 1, 1: 1, 2: 131, 3: 2622, 4: 6884}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!