ID: 1133465744_1133465748

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1133465744 1133465748
Species Human (GRCh38) Human (GRCh38)
Location 16:6025448-6025470 16:6025467-6025489
Sequence CCTACTTAGATTTTCTTTCTCTG TCTGGGGCCTCCCTTCAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 79, 4: 684} {0: 1, 1: 0, 2: 0, 3: 11, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!