ID: 1133507775_1133507784

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1133507775 1133507784
Species Human (GRCh38) Human (GRCh38)
Location 16:6429293-6429315 16:6429330-6429352
Sequence CCCTGGGATCTTTGCCAGCTCCC CAGGGTTTCTTGTTGACCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 215} {0: 1, 1: 0, 2: 0, 3: 14, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!