ID: 1133512586_1133512589

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1133512586 1133512589
Species Human (GRCh38) Human (GRCh38)
Location 16:6474106-6474128 16:6474121-6474143
Sequence CCAGTGTCCATTTGTGTATGCAG GTATGCAGTCTATCCTTGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 235} {0: 1, 1: 4, 2: 181, 3: 4413, 4: 6107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!