ID: 1133522592_1133522599

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1133522592 1133522599
Species Human (GRCh38) Human (GRCh38)
Location 16:6573705-6573727 16:6573741-6573763
Sequence CCGAAAGAGACACTTGGTAGAGA AAGCCCGGCTGCGGGAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 160} {0: 1, 1: 0, 2: 0, 3: 15, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!