ID: 1133523541_1133523544

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1133523541 1133523544
Species Human (GRCh38) Human (GRCh38)
Location 16:6581704-6581726 16:6581724-6581746
Sequence CCTTAATGAGGGACTCACAGCTG CTGTGTTTATGGAGGTCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111} {0: 1, 1: 0, 2: 0, 3: 12, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!