ID: 1133616323_1133616325

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1133616323 1133616325
Species Human (GRCh38) Human (GRCh38)
Location 16:7480022-7480044 16:7480048-7480070
Sequence CCGATGTCCATGTGCTGACTCAG ACAACTGCCTTTCTTCTGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 235} {0: 1, 1: 0, 2: 4, 3: 19, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!