ID: 1133625168_1133625172

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1133625168 1133625172
Species Human (GRCh38) Human (GRCh38)
Location 16:7564221-7564243 16:7564241-7564263
Sequence CCCTCTTCCATCTGAGAACACAG CAGAAAAAAGGCACTCAAGCCGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 73, 3: 595, 4: 1849} {0: 1, 1: 0, 2: 1, 3: 29, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!