ID: 1133693274_1133693283

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1133693274 1133693283
Species Human (GRCh38) Human (GRCh38)
Location 16:8236573-8236595 16:8236616-8236638
Sequence CCGTCCACTGGGTCCCTCTCATG CTACAATTCAAGATGAGATCTGG
Strand - +
Off-target summary {0: 5, 1: 81, 2: 740, 3: 1483, 4: 3100} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!