ID: 1133740691_1133740694

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1133740691 1133740694
Species Human (GRCh38) Human (GRCh38)
Location 16:8648853-8648875 16:8648872-8648894
Sequence CCTGGGTGATTTGTGTGCACAGT CAGTAGTTTGAGAAGCTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 32, 3: 105, 4: 375} {0: 1, 1: 0, 2: 0, 3: 23, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!