ID: 1133802033_1133802041

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1133802033 1133802041
Species Human (GRCh38) Human (GRCh38)
Location 16:9092026-9092048 16:9092045-9092067
Sequence CCGCGGGAGGCCGCGGAGGATGG ATGGAGGAGCGGAAGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 73, 4: 747} {0: 1, 1: 1, 2: 13, 3: 246, 4: 2587}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!