ID: 1133893063_1133893066

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1133893063 1133893066
Species Human (GRCh38) Human (GRCh38)
Location 16:9899996-9900018 16:9900041-9900063
Sequence CCATGTCACTGGGTAATTATAGG TGAGATACACAACGTGATAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 167} {0: 1, 1: 0, 2: 0, 3: 10, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!