ID: 1133905168_1133905176

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1133905168 1133905176
Species Human (GRCh38) Human (GRCh38)
Location 16:10015825-10015847 16:10015871-10015893
Sequence CCTCATTAAACCATGTGGTAGGG TGTAATCCCAGCTCTTTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 88} {0: 1775, 1: 298238, 2: 328399, 3: 307186, 4: 311163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!