ID: 1133911634_1133911637

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1133911634 1133911637
Species Human (GRCh38) Human (GRCh38)
Location 16:10071485-10071507 16:10071521-10071543
Sequence CCTTCTTCACCCTAATAACACTG TTCAAGTGCATTATGCCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 180} {0: 1, 1: 0, 2: 1, 3: 6, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!