ID: 1133916091_1133916093

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1133916091 1133916093
Species Human (GRCh38) Human (GRCh38)
Location 16:10111390-10111412 16:10111405-10111427
Sequence CCATCTGATCAGTGGCGGCACCG CGGCACCGGCTACGTGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40} {0: 1, 1: 1, 2: 2, 3: 10, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!