ID: 1133950535_1133950543

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1133950535 1133950543
Species Human (GRCh38) Human (GRCh38)
Location 16:10387984-10388006 16:10388016-10388038
Sequence CCTCCTCCCTCCGGGTTCAAGTG CCTCAGCCTTGCAAGTAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 17, 2: 730, 3: 13121, 4: 63383} {0: 117, 1: 4361, 2: 107905, 3: 219726, 4: 257905}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!