|
Left Crispr |
Right Crispr |
Crispr ID |
1133950535 |
1133950543 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
16:10387984-10388006
|
16:10388016-10388038
|
Sequence |
CCTCCTCCCTCCGGGTTCAAGTG |
CCTCAGCCTTGCAAGTAGCTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 17, 2: 730, 3: 13121, 4: 63383} |
{0: 117, 1: 4361, 2: 107905, 3: 219726, 4: 257905} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|