ID: 1133997820_1133997826

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1133997820 1133997826
Species Human (GRCh38) Human (GRCh38)
Location 16:10761774-10761796 16:10761789-10761811
Sequence CCCTCCCACAACCGGGGGCGCGG GGGCGCGGAGCTCATGTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 51} {0: 1, 1: 0, 2: 0, 3: 12, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!