ID: 1134034597_1134034600

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1134034597 1134034600
Species Human (GRCh38) Human (GRCh38)
Location 16:11020189-11020211 16:11020236-11020258
Sequence CCAGAGATCGAGATGGTGATCAT GGCCGCCAGCACCTCCGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59} {0: 1, 1: 0, 2: 2, 3: 21, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!