ID: 1134056156_1134056162

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1134056156 1134056162
Species Human (GRCh38) Human (GRCh38)
Location 16:11171051-11171073 16:11171080-11171102
Sequence CCCATCTCCCTGGGGTCTGCCTG CTGTCTTCCCAAATGCAGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 319} {0: 1, 1: 0, 2: 1, 3: 18, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!