ID: 1134243793_1134243798

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1134243793 1134243798
Species Human (GRCh38) Human (GRCh38)
Location 16:12524854-12524876 16:12524875-12524897
Sequence CCCACGGACATGGGCCGCCAGCC CCCTGCCAGCATTTTTTTCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73} {0: 1, 1: 0, 2: 5, 3: 40, 4: 447}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!