ID: 1134243794_1134243798

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1134243794 1134243798
Species Human (GRCh38) Human (GRCh38)
Location 16:12524855-12524877 16:12524875-12524897
Sequence CCACGGACATGGGCCGCCAGCCC CCCTGCCAGCATTTTTTTCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 129} {0: 1, 1: 0, 2: 5, 3: 40, 4: 447}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!