ID: 1134247656_1134247665

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1134247656 1134247665
Species Human (GRCh38) Human (GRCh38)
Location 16:12552003-12552025 16:12552035-12552057
Sequence CCCTGTCTCTAAAAAACGTGGCA TCAGATGGGAAGGATTTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 68, 4: 785} {0: 1, 1: 0, 2: 2, 3: 20, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!