ID: 1134262934_1134262940

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1134262934 1134262940
Species Human (GRCh38) Human (GRCh38)
Location 16:12667455-12667477 16:12667495-12667517
Sequence CCTCAATAAATGAGATAGGCCAG TGTAATCCCTGTACTTTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 163} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!