ID: 1134290884_1134290893

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1134290884 1134290893
Species Human (GRCh38) Human (GRCh38)
Location 16:12902210-12902232 16:12902244-12902266
Sequence CCGCCTCCGGAGAGGCCAGCGAG ATCGGACGCGCCCCCGACCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 187} {0: 1, 1: 0, 2: 0, 3: 6, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!