ID: 1134494840_1134494849

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1134494840 1134494849
Species Human (GRCh38) Human (GRCh38)
Location 16:14724704-14724726 16:14724725-14724747
Sequence CCCCACCCAGTGGGGCCCCCATC TCTAATATTCTAAGTGTCAGAGG
Strand - +
Off-target summary {0: 9, 1: 0, 2: 18, 3: 14, 4: 289} {0: 18, 1: 4, 2: 5, 3: 16, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!