ID: 1134509875_1134509883

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1134509875 1134509883
Species Human (GRCh38) Human (GRCh38)
Location 16:14837436-14837458 16:14837486-14837508
Sequence CCCAAGGCCACGCAACACGTGGA CTGGGTTAACACTTCGTGTCTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 0, 3: 8, 4: 100} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!