ID: 1134526765_1134526774

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1134526765 1134526774
Species Human (GRCh38) Human (GRCh38)
Location 16:14950436-14950458 16:14950457-14950479
Sequence CCCCACCCAGTGGGGCCCCCATC TCTAATATTCTAAGTGTCAGAGG
Strand - +
Off-target summary {0: 9, 1: 0, 2: 18, 3: 14, 4: 289} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!